Orthologous regulated operons containing radA gene
| Regulog: | LexA - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Polaromonas sp. JS666 | ||||
|
Position: -30
Score: 5.66058 Sequence: TACTGGTTGTTTGTACAGTA
Locus tag: Bpro_0200
Name: radA Funciton: DNA repair protein RadA |
||||
| radA | -30 | 5.7 | TACTGGTTGTTTGTACAGTA | Bpro_0200 |
| Rhodoferax ferrireducens DSM 15236 | ||||
|
Position: -31
Score: 4.91177 Sequence: ATCTGTTTTTCCATACAGTA
Locus tag: Rfer_0500
Name: radA Funciton: DNA repair protein RadA |
||||
| radA | -31 | 4.9 | ATCTGTTTTTCCATACAGTA | Rfer_0500 |