Orthologous regulated operons containing PF06733 gene
| Regulog: | LexA - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||||
|
Position: -33
Score: 4.75125 Sequence: CACTGTATTTACAATCAGTG
Locus tag: Aave_0184
Name: Aave_0184 Funciton: Conserved hypothetical protein
Locus tag: Aave_0185
Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
| Aave_0184-PF06733 | -33 | 4.8 | CACTGTATTTACAATCAGTG | Aave_0184 |
| Acidovorax sp. JS42 | ||||
|
Position: -75
Score: 4.94001 Sequence: TGCTGGATGAAATCACAGTA
Locus tag: Ajs_2429
Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: Ajs_2428
Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
| PF08774-PF06733 | -75 | 4.9 | TGCTGGATGAAATCACAGTA | Ajs_2429 |
| Comamonas testosteroni KF-1 | ||||
|
Position: -6
Score: 5.55904 Sequence: AGCTGTATGAAAATACAGGT
Locus tag: CtesDRAFT_1895
Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: CtesDRAFT_1894
Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
| PF08774-PF06733 | -6 | 5.6 | AGCTGTATGAAAATACAGGT | CtesDRAFT_1895 |
| Delftia acidovorans SPH-1 | ||||
|
Position: -54
Score: 5.55406 Sequence: GACTGTATAAAGATACAGTT
Locus tag: Daci_5814
Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: Daci_5813
Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
| PF08774-PF06733 | -54 | 5.6 | GACTGTATAAAGATACAGTT | Daci_5814 |
| Methylibium petroleiphilum PM1 | ||||
|
Position: -49
Score: 5.43999 Sequence: TACTGTATTTACGAACAGTA
Locus tag: Mpe_A0910
Name: Aave_0184 Funciton: Conserved hypothetical protein
Locus tag: Mpe_A0909
Name: null Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
| Aave_0184-Mpe_A0909 | -49 | 5.4 | TACTGTATTTACGAACAGTA | Mpe_A0910 |
| Variovorax paradoxus S110 | ||||
|
Position: -26
Score: 4.9962 Sequence: TACTGTTGTTTTATACAGCA
Locus tag: Vapar_2806
Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
| PF06733 | -26 | 5 | TACTGTTGTTTTATACAGCA | Vapar_2806 |