Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Aave_0184 gene

Properties
Regulog: LexA - Comamonadaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Built upon 71 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -33
Score: 4.75125
Sequence: CACTGTATTTACAATCAGTG
Locus tag: Aave_0184
Name: Aave_0184
Funciton: Conserved hypothetical protein
Locus tag: Aave_0185
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
Aave_0184-PF06733 -33 4.8 CACTGTATTTACAATCAGTG Aave_0184
Methylibium petroleiphilum PM1
Position: -49
Score: 5.43999
Sequence: TACTGTATTTACGAACAGTA
Locus tag: Mpe_A0910
Name: Aave_0184
Funciton: Conserved hypothetical protein
Locus tag: Mpe_A0909
Name: null
Funciton: DinG family ATP-dependent helicase CPE1197
Aave_0184-Mpe_A0909 -49 5.4 TACTGTATTTACGAACAGTA Mpe_A0910
Variovorax paradoxus S110
Position: -32
Score: 6.38076
Sequence: TACTGTATAAAAATACAGTT
Locus tag: Vapar_3206
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Vapar_3205
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Vapar_3204
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
Locus tag: Vapar_3203
Name: Aave_0184
Funciton: Conserved hypothetical protein
imuA-imuB-dnaE2-Aave_0184 -32 6.4 TACTGTATAAAAATACAGTT Vapar_3206
© 2009-2020 RegPrecise