Orthologous regulated operons containing rstA gene
| Regulog: | LexA - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -89
Score: 3.97129 Sequence: GGCTGTTTTTTTGTACATTA
Locus tag: VC1454
Name: null Funciton: RstA phage-related replication protein
Locus tag: VC1453
Name: null Funciton: RstB phage-related integrase |
||||
| VC1454-VC1453 | -89 | 4 | GGCTGTTTTTTTGTACATTA | VC1454 |