Orthologous regulated operons containing ATW7_03087 gene
| Regulog: | LexA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonadales bacterium TW-7 | ||||
|
Position: -49
Score: 5.9019 Sequence: TACTGTACATTTAAACAGTG
Locus tag: ATW7_03087
Name: ATW7_03087 Funciton: Putative orphan protein |
||||
| ATW7_03087 | -49 | 5.9 | TACTGTACATTTAAACAGTG | ATW7_03087 |
| Pseudoalteromonas haloplanktis TAC125 | ||||
|
Position: -49
Score: 6.2612 Sequence: AACTGTATATATAAACAGTG
Locus tag: PSHAb0389
Name: ATW7_03087 Funciton: Putative orphan protein |
||||
| ATW7_03087 | -49 | 6.3 | AACTGTATATATAAACAGTG | PSHAb0389 |
| Pseudoalteromonas tunicata D2 | ||||
|
Position: -38
Score: 6.03334 Sequence: CACTGTATATAAAAACAGTG
Locus tag: PTD2_02786
Name: ATW7_03087 Funciton: Putative orphan protein |
||||
| ATW7_03087 | -38 | 6 | CACTGTATATAAAAACAGTG | PTD2_02786 |