Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing dnaE2 gene

Properties
Regulog: LexA - Alteromonadales
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Built upon 111 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Idiomarina baltica OS145
Position: -36
Score: 6.28869
Sequence: TACTGTACATATATACAGTA
Locus tag: OS145_09460
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: OS145_09455
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: OS145_09450
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA-imuB-dnaE2 -36 6.3 TACTGTACATATATACAGTA OS145_09460
Idiomarina loihiensis L2TR
Position: -32
Score: 6.30653
Sequence: TACTGTATATATGTACAGTA
Locus tag: IL2568
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: IL2567
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: IL2566
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA-imuB-dnaE2 -32 6.3 TACTGTATATATGTACAGTA IL2568
© 2009-2020 RegPrecise