Orthologous regulated operons containing dnaE2 gene
| Regulog: | LexA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina baltica OS145 | ||||
|
Position: -36
Score: 6.28869 Sequence: TACTGTACATATATACAGTA
Locus tag: OS145_09460
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: OS145_09455
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: OS145_09450
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| imuA-imuB-dnaE2 | -36 | 6.3 | TACTGTACATATATACAGTA | OS145_09460 |
| Idiomarina loihiensis L2TR | ||||
|
Position: -32
Score: 6.30653 Sequence: TACTGTATATATGTACAGTA
Locus tag: IL2568
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: IL2567
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: IL2566
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| imuA-imuB-dnaE2 | -32 | 6.3 | TACTGTATATATGTACAGTA | IL2568 |