Orthologous regulated operons containing uvrB gene
| Regulog: | LexA - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -46
Score: 4.83342 Sequence: AGGTGTATATATATACAGCC
Locus tag: VIBHAR_02961
Name: uvrB Funciton: Excinuclease ABC subunit B |
||||
| uvrB | -46 | 4.8 | AGGTGTATATATATACAGCC | VIBHAR_02961 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -74
Score: 4.9601 Sequence: AGGTGTATATATATACAGCG
Locus tag: VP2100
Name: uvrB Funciton: Excinuclease ABC subunit B |
||||
| uvrB | -74 | 5 | AGGTGTATATATATACAGCG | VP2100 |
| Vibrio splendidus LGP32 | ||||
|
Position: -35
Score: 4.99543 Sequence: ACCTGATTAAAAAAACAGTA
Locus tag: VS_0980
Name: uvrB Funciton: Excinuclease ABC subunit B |
||||
| uvrB | -35 | 5 | ACCTGATTAAAAAAACAGTA | VS_0980 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -48
Score: 5.31307 Sequence: GAGTGTATATTTATACAGTT
Locus tag: VV1_3092
Name: uvrB Funciton: Excinuclease ABC subunit B |
||||
| uvrB | -48 | 5.3 | GAGTGTATATTTATACAGTT | VV1_3092 |