Orthologous regulated operons containing topB gene
Regulog: | LexA - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | LexA |
Regulation mode: | repressor |
Biological process: | SOS response |
Effector: | DNA damage |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Photobacterium profundum SS9 | ||||
Position: -88
Score: 5.22896 Sequence: AACTGTTGTTATATCCAGTA
Locus tag: PBPRA2590
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -88 | 5.2 | AACTGTTGTTATATCCAGTA | PBPRA2590 |
Vibrio angustum S14 | ||||
Position: -86
Score: 5.6407 Sequence: AACTGGTTTTATATCCAGTA
Locus tag: VAS14_05738
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -86 | 5.6 | AACTGGTTTTATATCCAGTA | VAS14_05738 |
Vibrio cholerae O1 biovar eltor str. N16961 | ||||
Position: -84
Score: 5.51335 Sequence: TACTGGTTAAATTTACAGTT
Locus tag: VC2043
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -84 | 5.5 | TACTGGTTAAATTTACAGTT | VC2043 |
Vibrio fischeri ES114 | ||||
Position: -29
Score: 5.31483 Sequence: AACTGTCTATTCATACAGGT
Locus tag: VF_1641
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -29 | 5.3 | AACTGTCTATTCATACAGGT | VF_1641 |
Vibrio harveyi ATCC BAA-1116 | ||||
Position: -84
Score: 5.05334 Sequence: TACTGTTTACCTGTACAGTT
Locus tag: VIBHAR_03041
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -84 | 5.1 | TACTGTTTACCTGTACAGTT | VIBHAR_03041 |
Vibrio parahaemolyticus RIMD 2210633 | ||||
Position: -85
Score: 5.73735 Sequence: TACTGTTCATTTATACAGTT
Locus tag: VP2149
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -85 | 5.7 | TACTGTTCATTTATACAGTT | VP2149 |
Vibrio salmonicida LFI1238 | ||||
Position: -57
Score: 4.90115 Sequence: AACTGTCTATTCGTACAGGT
Locus tag: VSAL_I2155
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -57 | 4.9 | AACTGTCTATTCGTACAGGT | VSAL_I2155 |
Vibrio shilonii AK1 | ||||
Position: -90
Score: 5.52833 Sequence: AACTGGCTATTTATACAGTT
Locus tag: VSAK1_03504
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -90 | 5.5 | AACTGGCTATTTATACAGTT | VSAK1_03504 |
Vibrio splendidus LGP32 | ||||
Position: -85
Score: 5.98156 Sequence: AACTGTATAAACAACCAGTT
Locus tag: VS_0940
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -85 | 6 | AACTGTATAAACAACCAGTT | VS_0940 |
Vibrio vulnificus CMCP6 | ||||
Position: -87
Score: 5.75784 Sequence: AACTGTCTATACATACAGTT
Locus tag: VV1_3130
Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2) |
||||
topB | -87 | 5.8 | AACTGTCTATACATACAGTT | VV1_3130 |