Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO0074 gene

Properties
Regulog: SO0072 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Phylum: Proteobacteria/gamma
Built upon 29 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Sama_3574
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sama_3573
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Sama_3572
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Sama_3574
Shewanella baltica OS155
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Sbal_4277
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sbal_4276
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Sbal_4275
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Sbal_4277
Shewanella denitrificans OS217
Position: -34
Score: 6.86474
Sequence: TGTATCAATGAATTAATACA
Locus tag: Sden_0069
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sden_0070
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Sden_0071
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 6.9 TGTATCAATGAATTAATACA Sden_0069
Shewanella frigidimarina NCIMB 400
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Sfri_3976
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sfri_3975
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Sfri_3974
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Sfri_3976
Shewanella loihica PV-4
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Shew_3779
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Shew_3778
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Shew_3777
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Shew_3779
Shewanella oneidensis MR-1
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: SO_0072
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: SO_0073
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: SO_0074
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA SO_0072
Shewanella pealeana ATCC 700345
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Spea_4189
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Spea_4188
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Spea_4187
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Spea_4189
Shewanella piezotolerans WP3
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: swp_0109
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: swp_0110
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: swp_0111
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA swp_0109
Shewanella putrefaciens CN-32
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Sputcn32_0058
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sputcn32_0059
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Sputcn32_0060
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Sputcn32_0058
Shewanella sp ANA-3
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Shewana3_0077
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Shewana3_0078
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Shewana3_0079
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Shewana3_0077
Shewanella sp MR-4
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Shewmr4_0075
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Shewmr4_0076
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Shewmr4_0077
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Shewmr4_0075
Shewanella sp MR-7
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Shewmr7_0073
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Shewmr7_0074
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Shewmr7_0075
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Shewmr7_0073
Shewanella sp W3-18-1
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Sputw3181_4020
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sputw3181_4019
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Sputw3181_4018
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Sputw3181_4020
Shewanella woodyi ATCC 51908
Position: -34
Score: 7.13616
Sequence: TGTATCAATGTATTAATACA
Locus tag: Swoo_4863
Name: SO0072
Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Swoo_4862
Name: SO0073
Funciton: ABC transporter, ATP-binding protein
Locus tag: Swoo_4861
Name: SO0074
Funciton: ABC transporter permease protein
SO0072-SO0073-SO0074 -34 7.1 TGTATCAATGTATTAATACA Swoo_4863
© 2009-2020 RegPrecise