Orthologous regulated operons containing SO0072 gene
Regulog: | SO0072 - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Hypothetical ABC transporter |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella amazonensis SB2B | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Sama_3574
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sama_3573
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Sama_3572
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Sama_3574 |
Shewanella baltica OS155 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Sbal_4277
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sbal_4276
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Sbal_4275
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Sbal_4277 |
Shewanella denitrificans OS217 | ||||
Position: -34
Score: 6.86474 Sequence: TGTATCAATGAATTAATACA
Locus tag: Sden_0069
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sden_0070
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Sden_0071
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 6.9 | TGTATCAATGAATTAATACA | Sden_0069 |
Shewanella frigidimarina NCIMB 400 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Sfri_3976
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sfri_3975
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Sfri_3974
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Sfri_3976 |
Shewanella loihica PV-4 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Shew_3779
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Shew_3778
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Shew_3777
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Shew_3779 |
Shewanella oneidensis MR-1 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: SO_0072
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: SO_0073
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: SO_0074
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | SO_0072 |
Shewanella pealeana ATCC 700345 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Spea_4189
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Spea_4188
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Spea_4187
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Spea_4189 |
Shewanella piezotolerans WP3 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: swp_0109
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: swp_0110
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: swp_0111
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | swp_0109 |
Shewanella putrefaciens CN-32 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Sputcn32_0058
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sputcn32_0059
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Sputcn32_0060
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Sputcn32_0058 |
Shewanella sp ANA-3 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Shewana3_0077
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Shewana3_0078
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Shewana3_0079
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Shewana3_0077 |
Shewanella sp MR-4 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Shewmr4_0075
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Shewmr4_0076
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Shewmr4_0077
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Shewmr4_0075 |
Shewanella sp MR-7 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Shewmr7_0073
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Shewmr7_0074
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Shewmr7_0075
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Shewmr7_0073 |
Shewanella sp W3-18-1 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Sputw3181_4020
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Sputw3181_4019
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Sputw3181_4018
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Sputw3181_4020 |
Shewanella woodyi ATCC 51908 | ||||
Position: -34
Score: 7.13616 Sequence: TGTATCAATGTATTAATACA
Locus tag: Swoo_4863
Name: SO0072 Funciton: Transcriptional regulator, GntR family, YtrA subfamily
Locus tag: Swoo_4862
Name: SO0073 Funciton: ABC transporter, ATP-binding protein
Locus tag: Swoo_4861
Name: SO0074 Funciton: ABC transporter permease protein |
||||
SO0072-SO0073-SO0074 | -34 | 7.1 | TGTATCAATGTATTAATACA | Swoo_4863 |