Orthologous regulated operons containing manR2 gene

Properties
Regulog:	ManR2 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Phylum:	Proteobacteria/gamma

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -220 Score: 6.66299 Sequence: CACTGTAATCGATTACATTT Position: -126 Score: 6.31665 Sequence: TTATGGAATCGATTACATCT Locus tag: Sama_0294 Name: manR2 Funciton: Transcriptional regulator of mannoside utilization, variant 2, LacI family
manR2	-220	6.7	CACTGTAATCGATTACATTT	Sama_0294
	-126	6.3	TTATGGAATCGATTACATCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --