Orthologous regulated operons containing mnnA2 gene
Regulog: | ManR1 - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Mannose utilization; Mannosides utilization |
Effector: | Mannose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella amazonensis SB2B | ||||
Position: -76
Score: 7.09642 Sequence: AAATTGGAACGTTCCAATTG
Locus tag: Sama_0564
Name: mnnA1 Funciton: Alpha-1,2-mannosidase
Locus tag: Sama_0563
Name: mnnA2 Funciton: Alpha-1,2-mannosidase
Locus tag: Sama_0562
Name: manP1 Funciton: Predicted mannose transporter, GGP family
Locus tag: Sama_0561
Name: manK Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
Locus tag: Sama_0560
Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7) |
||||
mnnA1-mnnA2-manP1-manK-manI | -76 | 7.1 | AAATTGGAACGTTCCAATTG | Sama_0564 |
Shewanella sp MR-7 | ||||
Position: -76
Score: 6.71543 Sequence: AAATTGGAACGTTCCAAAAA
Locus tag: Shewmr7_3384
Name: mnnA1 Funciton: Alpha-1,2-mannosidase
Locus tag: Shewmr7_3385
Name: mnnA2 Funciton: Alpha-1,2-mannosidase
Locus tag: Shewmr7_3386
Name: manP1 Funciton: Predicted mannose transporter, GGP family
Locus tag: Shewmr7_3387
Name: manK Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
Locus tag: Shewmr7_3388
Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7) |
||||
mnnA1-mnnA2-manP1-manK-manI | -76 | 6.7 | AAATTGGAACGTTCCAAAAA | Shewmr7_3384 |