Orthologous regulated operons containing mnnA2 gene

Properties
Regulog:	ManR1 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Phylum:	Proteobacteria/gamma

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -76 Score: 7.09642 Sequence: AAATTGGAACGTTCCAATTG Locus tag: Sama_0564 Name: mnnA1 Funciton: Alpha-1,2-mannosidase Locus tag: Sama_0563 Name: mnnA2 Funciton: Alpha-1,2-mannosidase Locus tag: Sama_0562 Name: manP1 Funciton: Predicted mannose transporter, GGP family Locus tag: Sama_0561 Name: manK Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) Locus tag: Sama_0560 Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7)
mnnA1-mnnA2-manP1-manK-manI	-76	7.1	AAATTGGAACGTTCCAATTG	Sama_0564
Shewanella sp MR-7
Position: -76 Score: 6.71543 Sequence: AAATTGGAACGTTCCAAAAA Locus tag: Shewmr7_3384 Name: mnnA1 Funciton: Alpha-1,2-mannosidase Locus tag: Shewmr7_3385 Name: mnnA2 Funciton: Alpha-1,2-mannosidase Locus tag: Shewmr7_3386 Name: manP1 Funciton: Predicted mannose transporter, GGP family Locus tag: Shewmr7_3387 Name: manK Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) Locus tag: Shewmr7_3388 Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7)
mnnA1-mnnA2-manP1-manK-manI	-76	6.7	AAATTGGAACGTTCCAAAAA	Shewmr7_3384

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --