Orthologous regulated operons containing galP2 gene
Regulog: | GalR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Galactose utilization |
Effector: | Galactose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella woodyi ATCC 51908 | ||||
Position: -51
Score: 5.83185 Sequence: AAATGGAAACGTTTACATTT
Locus tag: Swoo_2084
Name: galT2 Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
Locus tag: Swoo_2085
Name: galK2 Funciton: Galactokinase (EC 2.7.1.6)
Locus tag: Swoo_2086
Name: galP2 Funciton: Predicted sodium-dependent galactose transporter |
||||
galT2-galK2-galP2 | -51 | 5.8 | AAATGGAAACGTTTACATTT | Swoo_2084 |