Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing imuA gene

Properties
Regulog: LexA - Shewanellaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Built upon 192 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -66
Score: 5.88947
Sequence: TACTGTATAAATATACAGTT
Locus tag: Sama_1865
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Sama_1864
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Sama_1863
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA-imuB-dnaE2 -66 5.9 TACTGTATAAATATACAGTT Sama_1865
Shewanella loihica PV-4
Position: -145
Score: 6.09207
Sequence: TACTGTATTTATATACAGTG
Locus tag: Shew_2102
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Shew_2101
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Shew_2100
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA-imuB-dnaE2 -145 6.1 TACTGTATTTATATACAGTG Shew_2102