Orthologous regulated operons containing recX gene
Regulog: | LexA - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | LexA |
Regulation mode: | repressor |
Biological process: | SOS response |
Effector: | DNA damage |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella amazonensis SB2B | ||||
Position: -115
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: Sama_1046
Name: recA Funciton: Recombinase A
Locus tag: Sama_1047
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -115 | 5.6 | TACTGTATGATTGTACAGTA | Sama_1046 |
Shewanella baltica OS155 | ||||
Position: -127
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: Sbal_3117
Name: recA Funciton: Recombinase A
Locus tag: Sbal_3116
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -127 | 5.6 | TACTGTATGATTGTACAGTA | Sbal_3117 |
Shewanella loihica PV-4 | ||||
Position: -127
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: Shew_1215
Name: recA Funciton: Recombinase A
Locus tag: Shew_1216
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -127 | 5.6 | TACTGTATGATTGTACAGTA | Shew_1215 |
Shewanella oneidensis MR-1 | ||||
Position: -127
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: SO_3430
Name: recA Funciton: Recombinase A
Locus tag: SO_3429
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -127 | 5.6 | TACTGTATGATTGTACAGTA | SO_3430 |
Shewanella putrefaciens CN-32 | ||||
Position: -129
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: Sputcn32_2747
Name: recA Funciton: Recombinase A
Locus tag: Sputcn32_2746
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -129 | 5.6 | TACTGTATGATTGTACAGTA | Sputcn32_2747 |
Shewanella sp ANA-3 | ||||
Position: -128
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: Shewana3_1126
Name: recA Funciton: Recombinase A
Locus tag: Shewana3_1127
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -128 | 5.6 | TACTGTATGATTGTACAGTA | Shewana3_1126 |
Shewanella sp MR-4 | ||||
Position: -128
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: Shewmr4_1125
Name: recA Funciton: Recombinase A
Locus tag: Shewmr4_1126
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -128 | 5.6 | TACTGTATGATTGTACAGTA | Shewmr4_1125 |
Shewanella sp MR-7 | ||||
Position: -128
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: Shewmr7_1196
Name: recA Funciton: Recombinase A
Locus tag: Shewmr7_1197
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -128 | 5.6 | TACTGTATGATTGTACAGTA | Shewmr7_1196 |
Shewanella sp W3-18-1 | ||||
Position: -129
Score: 5.59316 Sequence: TACTGTATGATTGTACAGTA
Locus tag: Sputw3181_1265
Name: recA Funciton: Recombinase A
Locus tag: Sputw3181_1266
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -129 | 5.6 | TACTGTATGATTGTACAGTA | Sputw3181_1265 |