Orthologous regulated operons containing acrB gene
| Regulog: | SoxR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | repressor |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella piezotolerans WP3 | ||||
|
Position: -69
Score: 6.72362 Sequence: ACCTCAAGTTAACTTGATGT
Locus tag: swp_2308
Name: acrA Funciton: Probable RND efflux membrane fusion protein
Locus tag: swp_2309
Name: acrB Funciton: RND multidrug efflux transporter |
||||
| acrA-acrB | -69 | 6.7 | ACCTCAAGTTAACTTGATGT | swp_2308 |