Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing acrB gene

Properties
Regulog: SoxR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella piezotolerans WP3
Position: -69
Score: 6.72362
Sequence: ACCTCAAGTTAACTTGATGT
Locus tag: swp_2308
Name: acrA
Funciton: Probable RND efflux membrane fusion protein
Locus tag: swp_2309
Name: acrB
Funciton: RND multidrug efflux transporter
acrA-acrB -69 6.7 ACCTCAAGTTAACTTGATGT swp_2308
© 2009-2020 RegPrecise