Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF11158 gene

Properties
Regulog: SoxR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -62
Score: 6.19153
Sequence: ACCTCAAGTTGACTTGAAGT
Locus tag: Sama_3348
Name: PF11158
Funciton: Protein of unknown function DUF2938
PF11158 -62 6.2 ACCTCAAGTTGACTTGAAGT Sama_3348
Shewanella loihica PV-4
Position: -65
Score: 5.65944
Sequence: ACCTCAAGTCGACTTGAAGT
Locus tag: Shew_0422
Name: PF11158
Funciton: Protein of unknown function DUF2938
PF11158 -65 5.7 ACCTCAAGTCGACTTGAAGT Shew_0422
© 2009-2020 RegPrecise