Orthologous regulated operons containing pgm2 gene
Regulog: | TreR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Trehalose utilization |
Effector: | Trehalose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella woodyi ATCC 51908 | ||||
Position: -73
Score: 6.37839 Sequence: TTTTGCAATCGTTTGCAAAA
Locus tag: Swoo_1437
Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64)
Locus tag: Swoo_1436
Name: pgm2 Funciton: beta-phosphoglucomutase |
||||
treP-pgm2 | -73 | 6.4 | TTTTGCAATCGTTTGCAAAA | Swoo_1437 |