Orthologous regulated operons containing omp(Tre) gene
| Regulog: | TreR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella frigidimarina NCIMB 400 | ||||
|
Position: -133
Score: 6.46552 Sequence: AAATGCAAACGTTTGCATAA
Position: -110
Score: 6.38775 Sequence: TATTGCAAACGTTTGCATTG
Locus tag: Sfri_3503
Name: omp(Tre) Funciton: Trehalose-regulated TonB-dependent outer membrane receptor |
||||
| omp(Tre) | -133 | 6.5 | AAATGCAAACGTTTGCATAA | Sfri_3503 |
| -110 | 6.4 | TATTGCAAACGTTTGCATTG | ||
| Shewanella woodyi ATCC 51908 | ||||
|
Position: -160
Score: 6.44024 Sequence: AAATGCAAACGATTGCAAAA
Position: -137
Score: 5.99443 Sequence: AATTGCAATCGTTTGCAAGC
Locus tag: Swoo_1434
Name: omp(Tre) Funciton: Trehalose-regulated TonB-dependent outer membrane receptor |
||||
| omp(Tre) | -160 | 6.4 | AAATGCAAACGATTGCAAAA | Swoo_1434 |
| -137 | 6 | AATTGCAATCGTTTGCAAGC | ||