Orthologous regulated operons containing treF gene
| Regulog: | TreR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella frigidimarina NCIMB 400 | ||||
|
Position: -72
Score: 6.54952 Sequence: AAATGCAAACGATTGCATTA
Locus tag: Sfri_3505
Name: treT Funciton: Predicted trehalose permease, MFS family, FucP subfamily
Locus tag: Sfri_3506
Name: treF Funciton: Trehalase (EC 3.2.1.28) |
||||
| treT-treF | -72 | 6.5 | AAATGCAAACGATTGCATTA | Sfri_3505 |