Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing treF gene

Properties
Regulog: TreR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Proteobacteria/gamma
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella frigidimarina NCIMB 400
Position: -72
Score: 6.54952
Sequence: AAATGCAAACGATTGCATTA
Locus tag: Sfri_3505
Name: treT
Funciton: Predicted trehalose permease, MFS family, FucP subfamily
Locus tag: Sfri_3506
Name: treF
Funciton: Trehalase (EC 3.2.1.28)
treT-treF -72 6.5 AAATGCAAACGATTGCATTA Sfri_3505
© 2009-2020 RegPrecise