Orthologous regulated operons containing rbsR gene
Regulog: | RbsR - Desulfovibrionales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Ribose utilization |
Effector: | Ribose |
Phylum: | Proteobacteria/delta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Desulfovibrio salexigens DSM 2638 | ||||
Position: -76
Score: 4.4644 Sequence: TTGCGCAAACGTTTCGATGA
Locus tag: Desal_2553
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Desal_2552
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Desal_2551
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Desal_2550
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: Desal_2549
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Desal_2548
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family |
||||
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR | -76 | 4.5 | TTGCGCAAACGTTTCGATGA | Desal_2553 |