Orthologous regulated operons containing nnrS gene
| Regulog: | NsrR - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Psychromonas ingrahamii 37 | ||||
|
Position: -49
Score: 5.22459 Sequence: AGATGTAAAATAAATACATCT
Locus tag: Ping_0631
Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
Locus tag: Ping_0630
Name: nnrS Funciton: NnrS protein involved in response to NO |
||||
| nsrR-nnrS | -49 | 5.2 | AGATGTAAAATAAATACATCT | Ping_0631 |