Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nnrS gene

Properties
Regulog: NsrR - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Psychromonas ingrahamii 37
Position: -49
Score: 5.22459
Sequence: AGATGTAAAATAAATACATCT
Locus tag: Ping_0631
Name: nsrR
Funciton: Nitrite-sensitive transcriptional repressor NsrR
Locus tag: Ping_0630
Name: nnrS
Funciton: NnrS protein involved in response to NO
nsrR-nnrS -49 5.2 AGATGTAAAATAAATACATCT Ping_0631