Orthologous regulated operons containing nnrS gene

Properties
Regulog:	NsrR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Proteobacteria/gamma

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Psychromonas ingrahamii 37
Position: -49 Score: 5.22459 Sequence: AGATGTAAAATAAATACATCT Locus tag: Ping_0631 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR Locus tag: Ping_0630 Name: nnrS Funciton: NnrS protein involved in response to NO
nsrR-nnrS	-49	5.2	AGATGTAAAATAAATACATCT	Ping_0631

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --