Orthologous regulated operons containing nadE gene
| Regulog: | NrtR2 - Cyanobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Cyanobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Synechococcus sp. PCC 7002 | ||||
|
Position: -123
Score: 5.67676 Sequence: TTGATGTAGAATCGACACTAA
Locus tag: SYNPCC7002_A1784
Name: nadE Funciton: NAD synthetase (EC 6.3.1.5) |
||||
| nadE | -123 | 5.7 | TTGATGTAGAATCGACACTAA | SYNPCC7002_A1784 |