Orthologous regulated operons containing draG gene
| Regulog: | NrtR2 - Cyanobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Cyanobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cyanothece sp. PCC 7425 | ||||
|
Position: -49
Score: 5.13245 Sequence: ATAGTGTTATTGAGACACTAT
Position: -26
Score: 5.92812 Sequence: TTAGTGTAGTTTATACACAAA
Locus tag: Cyan7425_2213
Name: null Funciton: hypothetical protein
Locus tag: Cyan7425_2212
Name: draG Funciton: ADP-ribosylglycohydrolase superfamkily
Locus tag: Cyan7425_2211
Name: null Funciton: hypothetical protein
Locus tag: Cyan7425_2210
Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19)
Locus tag: Cyan7425_2209
Name: null Funciton: hypothetical protein |
||||
| Cyan7425_2213-draG-Cyan7425_2211-pncA-Cyan7425_2209 | -49 | 5.1 | ATAGTGTTATTGAGACACTAT | Cyan7425_2213 |
| -26 | 5.9 | TTAGTGTAGTTTATACACAAA | ||