Orthologous regulated operons containing Cyan7425_2213 gene

Properties
Regulog:	NrtR2 - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Cyanobacteria

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cyanothece sp. PCC 7425
Position: -49 Score: 5.13245 Sequence: ATAGTGTTATTGAGACACTAT Position: -26 Score: 5.92812 Sequence: TTAGTGTAGTTTATACACAAA Locus tag: Cyan7425_2213 Name: null Funciton: hypothetical protein Locus tag: Cyan7425_2212 Name: draG Funciton: ADP-ribosylglycohydrolase superfamkily Locus tag: Cyan7425_2211 Name: null Funciton: hypothetical protein Locus tag: Cyan7425_2210 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19) Locus tag: Cyan7425_2209 Name: null Funciton: hypothetical protein
Cyan7425_2213-draG-Cyan7425_2211-pncA-Cyan7425_2209	-49	5.1	ATAGTGTTATTGAGACACTAT	Cyan7425_2213
	-26	5.9	TTAGTGTAGTTTATACACAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --