Orthologous regulated operons containing xtpF gene

Properties
Regulog:	XylR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose; Glucose
Phylum:	Thermotogae

Built upon 39 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -254 Score: 5.76129 Sequence: GTTATTTTTTGTAAAGAAAAAAT Locus tag: TM0060 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: TM0059 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: TM0058 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: TM0057 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: TM0056 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: TM0055 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
xtpF-xtpG-xtpK-xtpL-xtpE-aguA	-254	5.8	GTTATTTTTTGTAAAGAAAAAAT	TM0060
Thermotoga naphthophila RKU-10
Position: -253 Score: 5.76129 Sequence: GTTATTTTTTGTAAAGAAAAAAT Locus tag: Tnap_0690 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: Tnap_0689 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: Tnap_0688 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: Tnap_0687 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: Tnap_0686 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: Tnap_0685 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
xtpF-xtpG-xtpK-xtpL-xtpE-aguA	-253	5.8	GTTATTTTTTGTAAAGAAAAAAT	Tnap_0690
Thermotoga neapolitana DSM 4359
Position: -245 Score: 5.28183 Sequence: GTTATTTCTTACGGAGAAAAAAT Locus tag: CTN_0633 Name: null Funciton: Transposase, IS605 OrfB family Locus tag: CTN_0634 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: CTN_0635 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: CTN_0636 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: CTN_0637 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: CTN_0638 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: CTN_0639 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
CTN_0633-xtpF-xtpG-xtpK-xtpL-xtpE-aguA	-245	5.3	GTTATTTCTTACGGAGAAAAAAT	CTN_0633
Thermotoga petrophila RKU-1
Position: -255 Score: 5.76129 Sequence: GTTATTTTTTGTAAAGAAAAAAT Locus tag: Tpet_0864 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: Tpet_0865 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: Tpet_0866 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: Tpet_0867 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: Tpet_0868 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: Tpet_0869 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
xtpF-xtpG-xtpK-xtpL-xtpE-aguA	-255	5.8	GTTATTTTTTGTAAAGAAAAAAT	Tpet_0864
Thermotoga sp. RQ2
Position: -254 Score: 5.76129 Sequence: GTTATTTTTTGTAAAGAAAAAAT Locus tag: TRQ2_0886 Name: xtpF Funciton: Xylan oligosaccharide ABC transporter, permease component 1 Locus tag: TRQ2_0887 Name: xtpG Funciton: Xylan oligosaccharide ABC transporter, permease component 2 Locus tag: TRQ2_0888 Name: xtpK Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1 Locus tag: TRQ2_0889 Name: xtpL Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2 Locus tag: TRQ2_0890 Name: xtpE Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component Locus tag: TRQ2_0891 Name: aguA Funciton: Alpha-glucuronidase (EC 3.2.1.139)
xtpF-xtpG-xtpK-xtpL-xtpE-aguA	-254	5.8	GTTATTTTTTGTAAAGAAAAAAT	TRQ2_0886