Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing CTN_0633 gene

Properties
Regulog: XylR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose; Glucose
Phylum: Thermotogae
Built upon 39 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga neapolitana DSM 4359
Position: -245
Score: 5.28183
Sequence: GTTATTTCTTACGGAGAAAAAAT
Locus tag: CTN_0633
Name: null
Funciton: Transposase, IS605 OrfB family
Locus tag: CTN_0634
Name: xtpF
Funciton: Xylan oligosaccharide ABC transporter, permease component 1
Locus tag: CTN_0635
Name: xtpG
Funciton: Xylan oligosaccharide ABC transporter, permease component 2
Locus tag: CTN_0636
Name: xtpK
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
Locus tag: CTN_0637
Name: xtpL
Funciton: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
Locus tag: CTN_0638
Name: xtpE
Funciton: Xylan oligosaccharide ABC transporter, substrate-binding component
Locus tag: CTN_0639
Name: aguA
Funciton: Alpha-glucuronidase (EC 3.2.1.139)
CTN_0633-xtpF-xtpG-xtpK-xtpL-xtpE-aguA -245 5.3 GTTATTTCTTACGGAGAAAAAAT CTN_0633
© 2009-2020 RegPrecise