Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing xylR gene

Properties
Regulog: XylR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose; Glucose
Phylum: Thermotogae
Built upon 39 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: -52
Score: 5.24436
Sequence: AATTTTTCGAGGAAATAAATAAT
Locus tag: Tlet_0350
Name: xloE
Funciton: Xylose oligosaccharides ABC transporter, sugar-binding protein
Locus tag: Tlet_0351
Name: xloF
Funciton: Xylose oligosaccharides ABC transporter, permease protein 1
Locus tag: Tlet_0352
Name: xloG
Funciton: Xylose oligosaccharides ABC transporter, permease protein 2
Locus tag: Tlet_0353
Name: xloK
Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 1
Locus tag: Tlet_0354
Name: xloL
Funciton: Xylose oligosaccharides ABC transporter, ATP-binding protein 2
Locus tag: Tlet_0355
Name: xyl3
Funciton: Beta-xylosidase (EC 3.2.1.37)
Locus tag: Tlet_0356
Name: axeA
Funciton: Acetyl xylan esterase (EC 3.1.1.41)
Locus tag: Tlet_0357
Name: xylR
Funciton: Xylose-responsive transcription regulator, ROK family
xloE-xloF-xloG-xloK-xloL-xyl3-axeA-xylR -52 5.2 AATTTTTCGAGGAAATAAATAAT Tlet_0350
© 2009-2020 RegPrecise