Orthologous regulated operons containing Tnap_1699 gene

Properties
Regulog:	RhaR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Rhamnose utilization; Rhamnose oligosaccharides utilization
Effector:	Rhamnose
Phylum:	Thermotogae

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga naphthophila RKU-10
Position: -42 Score: 5.71145 Sequence: ATTAGATAAATTTATGATAA Locus tag: Tnap_1699 Name: Tnap_1699 Funciton: predicted rhamnose ABC transporter, ATP-binding protein Locus tag: Tnap_1700 Name: Tnap_1700 Funciton: predicted rhamnose ABC transporter, permease protein Locus tag: Tnap_1701 Name: Tnap_1701 Funciton: predicted rhamnose ABC transporter, permease protein Locus tag: Tnap_1702 Name: Tnap_1702 Funciton: predicted rhamnose ABC transporter, solute-binding protein Locus tag: Tnap_1703 Name: gusB Funciton: putative beta-glucuronidase
Tnap_1699-Tnap_1700-Tnap_1701-Tnap_1702-gusB	-42	5.7	ATTAGATAAATTTATGATAA	Tnap_1699

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --