Orthologous regulated operons containing rtpL gene

Properties
Regulog:	RhaR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Rhamnose utilization; Rhamnose oligosaccharides utilization
Effector:	Rhamnose
Phylum:	Thermotogae

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -74 Score: 6.06447 Sequence: TGTTGATATTATATTGATAA Locus tag: TM1067 Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Locus tag: TM1066 Name: rtpF Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 1 Locus tag: TM1065 Name: rtpG Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 2 Locus tag: TM1064 Name: rtpK Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2 Locus tag: TM1063 Name: rtpL Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1 Locus tag: TM1062 Name: gusB Funciton: putative beta-glucuronidase Locus tag: TM1061 Name: TM1061 Funciton: putative unsaturated glucuronyl hydrolase
rtpE-rtpF-rtpG-rtpK-rtpL-gusB-TM1061	-74	6.1	TGTTGATATTATATTGATAA	TM1067
Thermotoga petrophila RKU-1
Position: -78 Score: 5.67162 Sequence: AGTTGATATCATATTGATAA Position: -47 Score: 5.3023 Sequence: TTATGATAAATTTATGATCG Locus tag: Tpet_1677 Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Locus tag: Tpet_1678 Name: null Funciton: FG-GAP repeat protein Locus tag: Tpet_1679 Name: aguE2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein Locus tag: Tpet_1680 Name: aguF2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1 Locus tag: Tpet_1681 Name: aguG2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2 Locus tag: Tpet_1682 Name: ramA Funciton: alpha-L-rhamnosidase Locus tag: Tpet_1683 Name: rtpF Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 1 Locus tag: Tpet_1684 Name: rtpG Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 2 Locus tag: Tpet_1685 Name: rtpK Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2 Locus tag: Tpet_1686 Name: rtpL Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1 Locus tag: Tpet_1687 Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Locus tag: Tpet_1688 Name: bglJ Funciton: putative beta-glucosidase Locus tag: Tpet_1689 Name: gusB Funciton: putative beta-glucuronidase Locus tag: Tpet_1690 Name: TM1061 Funciton: putative unsaturated glucuronyl hydrolase
rtpE-Tpet_1678-aguE2-aguF2-aguG2-ramA-rtpF-rtpG-rtpK-rtpL-rtpE-bglJ-gusB-TM1061	-78	5.7	AGTTGATATCATATTGATAA	Tpet_1677
	-47	5.3	TTATGATAAATTTATGATCG