Orthologous regulated operons containing rtpL gene
Regulog: | RhaR - Thermotogales |
Regulator type: | Transcription factor |
Regulator family: | DeoR |
Regulation mode: | repressor |
Biological process: | Rhamnose utilization; Rhamnose oligosaccharides utilization |
Effector: | Rhamnose |
Phylum: | Thermotogae |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Thermotoga maritima MSB8 | ||||
Position: -74
Score: 6.06447 Sequence: TGTTGATATTATATTGATAA
Locus tag: TM1067
Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
Locus tag: TM1066
Name: rtpF Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 1
Locus tag: TM1065
Name: rtpG Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 2
Locus tag: TM1064
Name: rtpK Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2
Locus tag: TM1063
Name: rtpL Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1
Locus tag: TM1062
Name: gusB Funciton: putative beta-glucuronidase
Locus tag: TM1061
Name: TM1061 Funciton: putative unsaturated glucuronyl hydrolase |
||||
rtpE-rtpF-rtpG-rtpK-rtpL-gusB-TM1061 | -74 | 6.1 | TGTTGATATTATATTGATAA | TM1067 |
Thermotoga petrophila RKU-1 | ||||
Position: -78
Score: 5.67162 Sequence: AGTTGATATCATATTGATAA
Position: -47
Score: 5.3023 Sequence: TTATGATAAATTTATGATCG
Locus tag: Tpet_1677
Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
Locus tag: Tpet_1678
Name: null Funciton: FG-GAP repeat protein
Locus tag: Tpet_1679
Name: aguE2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein
Locus tag: Tpet_1680
Name: aguF2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1
Locus tag: Tpet_1681
Name: aguG2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2
Locus tag: Tpet_1682
Name: ramA Funciton: alpha-L-rhamnosidase
Locus tag: Tpet_1683
Name: rtpF Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 1
Locus tag: Tpet_1684
Name: rtpG Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 2
Locus tag: Tpet_1685
Name: rtpK Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2
Locus tag: Tpet_1686
Name: rtpL Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1
Locus tag: Tpet_1687
Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
Locus tag: Tpet_1688
Name: bglJ Funciton: putative beta-glucosidase
Locus tag: Tpet_1689
Name: gusB Funciton: putative beta-glucuronidase
Locus tag: Tpet_1690
Name: TM1061 Funciton: putative unsaturated glucuronyl hydrolase |
||||
rtpE-Tpet_1678-aguE2-aguF2-aguG2-ramA-rtpF-rtpG-rtpK-rtpL-rtpE-bglJ-gusB-TM1061 | -78 | 5.7 | AGTTGATATCATATTGATAA | Tpet_1677 |
-47 | 5.3 | TTATGATAAATTTATGATCG |