Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ramA gene

Properties
Regulog: RhaR - Thermotogales
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Rhamnose utilization; Rhamnose oligosaccharides utilization
Effector: Rhamnose
Phylum: Thermotogae
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga petrophila RKU-1
Position: -78
Score: 5.67162
Sequence: AGTTGATATCATATTGATAA
Position: -47
Score: 5.3023
Sequence: TTATGATAAATTTATGATCG
Locus tag: Tpet_1677
Name: rtpE
Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
Locus tag: Tpet_1678
Name: null
Funciton: FG-GAP repeat protein
Locus tag: Tpet_1679
Name: aguE2
Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein
Locus tag: Tpet_1680
Name: aguF2
Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1
Locus tag: Tpet_1681
Name: aguG2
Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2
Locus tag: Tpet_1682
Name: ramA
Funciton: alpha-L-rhamnosidase
Locus tag: Tpet_1683
Name: rtpF
Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 1
Locus tag: Tpet_1684
Name: rtpG
Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 2
Locus tag: Tpet_1685
Name: rtpK
Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2
Locus tag: Tpet_1686
Name: rtpL
Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1
Locus tag: Tpet_1687
Name: rtpE
Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
Locus tag: Tpet_1688
Name: bglJ
Funciton: putative beta-glucosidase
Locus tag: Tpet_1689
Name: gusB
Funciton: putative beta-glucuronidase
Locus tag: Tpet_1690
Name: TM1061
Funciton: putative unsaturated glucuronyl hydrolase
rtpE-Tpet_1678-aguE2-aguF2-aguG2-ramA-rtpF-rtpG-rtpK-rtpL-rtpE-bglJ-gusB-TM1061 -78 5.7 AGTTGATATCATATTGATAA Tpet_1677
-47 5.3 TTATGATAAATTTATGATCG