Orthologous regulated operons containing rhaA gene
| Regulog: | RhaR - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization; Rhamnose oligosaccharides utilization |
| Effector: | Rhamnose |
| Phylum: | Thermotogae |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermotoga maritima MSB8 | ||||
|
Position: -56
Score: 6.6572 Sequence: TTGTGATTAATTTATGATAA
Locus tag: TM1070
Name: rhaM2 Funciton: L-rhamnose mutarotase, alternative
Locus tag: TM1071
Name: rhaA Funciton: Alternative L-rhamnose isomerase (EC 5.3.1.14)
Locus tag: TM1072
Name: rhaD Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
Locus tag: TM1073
Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
Locus tag: TM1074
Name: rhaC Funciton: glycoside hydrolase family 2 sugar binding |
||||
| rhaM2-rhaA-rhaD-rhaB-rhaC | -56 | 6.7 | TTGTGATTAATTTATGATAA | TM1070 |
| Thermotoga naphthophila RKU-10 | ||||
|
Position: -57
Score: 6.6572 Sequence: TTGTGATTAATTTATGATAA
Locus tag: Tnap_1697
Name: rhaM2 Funciton: L-rhamnose mutarotase, alternative
Locus tag: Tnap_1696
Name: rhaA Funciton: Alternative L-rhamnose isomerase (EC 5.3.1.14)
Locus tag: Tnap_1695
Name: rhaD Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
Locus tag: Tnap_1694
Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
Locus tag: Tnap_1693
Name: rhaC Funciton: glycoside hydrolase family 2 sugar binding |
||||
| rhaM2-rhaA-rhaD-rhaB-rhaC | -57 | 6.7 | TTGTGATTAATTTATGATAA | Tnap_1697 |
| Thermotoga neapolitana DSM 4359 | ||||
|
Position: -57
Score: 6.6572 Sequence: TTGTGATTAATTTATGATAA
Locus tag: CTN_1499
Name: rhaM2 Funciton: L-rhamnose mutarotase, alternative
Locus tag: CTN_1498
Name: rhaA Funciton: Alternative L-rhamnose isomerase (EC 5.3.1.14)
Locus tag: CTN_1497
Name: rhaD Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
Locus tag: CTN_1496
Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
Locus tag: CTN_1495
Name: rhaC Funciton: glycoside hydrolase family 2 sugar binding |
||||
| rhaM2-rhaA-rhaD-rhaB-rhaC | -57 | 6.7 | TTGTGATTAATTTATGATAA | CTN_1499 |
| Thermotoga petrophila RKU-1 | ||||
|
Position: -56
Score: 6.6572 Sequence: TTGTGATTAATTTATGATAA
Locus tag: Tpet_1674
Name: rhaM2 Funciton: L-rhamnose mutarotase, alternative
Locus tag: Tpet_1673
Name: rhaA Funciton: Alternative L-rhamnose isomerase (EC 5.3.1.14)
Locus tag: Tpet_1672
Name: rhaD Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
Locus tag: Tpet_1671
Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
Locus tag: Tpet_1670
Name: rhaC Funciton: glycoside hydrolase family 2 sugar binding |
||||
| rhaM2-rhaA-rhaD-rhaB-rhaC | -56 | 6.7 | TTGTGATTAATTTATGATAA | Tpet_1674 |