Orthologous regulated operons containing Cbei_2379 gene
Regulog: | XylR - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | ROK |
Regulation mode: | repressor |
Biological process: | Xylose utilization |
Effector: | Xylose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium beijerincki NCIMB 8052 | ||||
Position: -78
Score: 5.92116 Sequence: CATTATTAAAGGACATTTTAAAAGT
Locus tag: Cbei_2377
Name: xylF1 Funciton: Predicted beta-xyloside ABC transporter, substrate-binding component
Locus tag: Cbei_2378
Name: Cbei_2378 Funciton: Two-component sensor histidine kinase
Locus tag: Cbei_2379
Name: Cbei_2379 Funciton: Two-component response regulator yesN
Locus tag: Cbei_2380
Name: xylF Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF
Locus tag: Cbei_2381
Name: xylG Funciton: D-xylose transport ATP-binding protein XylG
Locus tag: Cbei_2382
Name: xylH Funciton: Xylose ABC transporter, permease protein XylH |
||||
xylF1-Cbei_2378-Cbei_2379-xylF-xylG-xylH | -78 | 5.9 | CATTATTAAAGGACATTTTAAAAGT | Cbei_2377 |