Orthologous regulated operons containing ribU gene
Regulog: | RbkR - Thermococcales |
Regulator type: | Transcription factor |
Regulator family: | [Other] |
Regulation mode: | |
Biological process: | Riboflavin biosynthesis |
Effector: | Flavin mononucleotide |
Phylum: | Euryarchaeota |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pyrococcus abyssi GE5 | ||||
Position: -62
Score: 5.50143 Sequence: TCGTTCAAAATTTGGAACAT
Locus tag: PAB2198
Name: ribU Funciton: Substrate-specific component RibU of riboflavin ECF transporter |
||||
ribU | -62 | 5.5 | TCGTTCAAAATTTGGAACAT | PAB2198 |
Pyrococcus furiosus DSM 3638 | ||||
Position: 133
Score: 6.06914 Sequence: TTGTTCTGAAAATGGAACAA
Locus tag: PF0163
Name: ribU Funciton: Substrate-specific component RibU of riboflavin ECF transporter |
||||
ribU | 133 | 6.1 | TTGTTCTGAAAATGGAACAA | PF0163 |
Pyrococcus horikoshii OT3 | ||||
Position: -62
Score: 6.16034 Sequence: TTGTTCCAATTATAGAACAT
Locus tag: PH0251
Name: ribU Funciton: Substrate-specific component RibU of riboflavin ECF transporter |
||||
ribU | -62 | 6.2 | TTGTTCCAATTATAGAACAT | PH0251 |
Thermococcus kodakaraensis KOD1 | ||||
Position: -62
Score: 6.1196 Sequence: TTGTTCTATGTATGGAACAA
Locus tag: TK2194
Name: ribU Funciton: Substrate-specific component RibU of riboflavin ECF transporter |
||||
ribU | -62 | 6.1 | TTGTTCTATGTATGGAACAA | TK2194 |
Thermococcus onnurineus NA1 | ||||
Position: -62
Score: 5.60532 Sequence: GTGTTTCATATTGGGAACAA
Locus tag: TON_1440
Name: ribU Funciton: Substrate-specific component RibU of riboflavin ECF transporter |
||||
ribU | -62 | 5.6 | GTGTTTCATATTGGGAACAA | TON_1440 |
Thermococcus sibiricus MM 739 | ||||
Position: -61
Score: 6.03545 Sequence: ATATTCCAATTATGGAACAA
Locus tag: TSIB_0195
Name: ribU Funciton: Substrate-specific component RibU of riboflavin ECF transporter |
||||
ribU | -61 | 6 | ATATTCCAATTATGGAACAA | TSIB_0195 |