Orthologous regulated operons containing PF11086 gene

Properties
Regulog:	PhrR - Pseudomonadaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Blue light; Adenosylcobalamin
Phylum:	Proteobacteria/Gamma

Built upon 43 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Pseudomonas entomophila L48
Position: -94 Score: 6.06155 Sequence: TGTACAAGACTATTGACCTGTACA Position: -43 Score: 4.64607 Sequence: TGTACAAAATCACCTCGCTGTACA Locus tag: PSEEN2706 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: PSEEN2705 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: PSEEN2704 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: PSEEN2703 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: PSEEN2702 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: PSEEN2701 Name: PF11086 Funciton: Protein of unknown function DUF2878
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086	-94	6.1	TGTACAAGACTATTGACCTGTACA	PSEEN2706
	-43	4.6	TGTACAAAATCACCTCGCTGTACA
Pseudomonas fluorescens Pf-5
Position: -97 Score: 6.48806 Sequence: TATACAAATAATTTGACTTGTACA Locus tag: PFL_5145 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: PFL_5146 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: PFL_5147 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: PFL_5148 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: PFL_5149 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: PFL_5150 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: PFL_5151 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: PFL_5152 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: PFL_5153 Name: PF11086 Funciton: Protein of unknown function DUF2878
COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086	-97	6.5	TATACAAATAATTTGACTTGTACA	PFL_5145
Pseudomonas mendocina ymp
Position: -92 Score: 6.38811 Sequence: TGTACAAATCATTTGACTTGTACA Position: -42 Score: 5.15889 Sequence: TGTACATGCACCAACATATGTACA Locus tag: Pmen_1073 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: Pmen_1072 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: Pmen_1071 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: Pmen_1070 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: Pmen_1069 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: Pmen_1068 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: Pmen_1067 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: Pmen_1066 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: Pmen_1065 Name: PF11086 Funciton: Protein of unknown function DUF2878
COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086	-92	6.4	TGTACAAATCATTTGACTTGTACA	Pmen_1073
	-42	5.2	TGTACATGCACCAACATATGTACA
Pseudomonas putida KT2440
Position: -94 Score: 6.08141 Sequence: TATACAAGACCGTTGACTTGTATA Position: -43 Score: 5.68758 Sequence: TGTACAACAATTCAATTTTGTACA Locus tag: PP2738 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: PP2737 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: PP2736 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: PP2735 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: PP2734 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: PP2733 Name: PF11086 Funciton: Protein of unknown function DUF2878
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086	-94	6.1	TATACAAGACCGTTGACTTGTATA	PP2738
	-43	5.7	TGTACAACAATTCAATTTTGTACA
Pseudomonas syringae pv. tomato str. DC3000
Position: -101 Score: 6.12539 Sequence: TCTACAAAGAATTTGACTTGTACA Position: -51 Score: 4.88574 Sequence: TGTACAGCACAGTTAATCTGTACA Locus tag: PSPTO1123 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: PSPTO1122 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: PSPTO1121 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: PSPTO1120 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: PSPTO1119 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: PSPTO1118 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: PSPTO1117 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: PSPTO1116 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: PSPTO1115 Name: PF11086 Funciton: Protein of unknown function DUF2878
COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086	-101	6.1	TCTACAAAGAATTTGACTTGTACA	PSPTO1123
	-51	4.9	TGTACAGCACAGTTAATCTGTACA