Orthologous regulated operons containing mcp4 gene
| Regulog: | PhrR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | repressor |
| Biological process: | Light-dependent DNA repair |
| Effector: | Blue light; Adenosylcobalamin |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas stutzeri A1501 | ||||
|
Position: -217
Score: 5.29583 Sequence: TATACATGGTTATTCGAATGTACA
Locus tag: PST_1966
Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: PST_1965
Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: PST_1964
Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: PST_1963
Name: PF07366 Funciton: Protein of unknown function DUF1486
Locus tag: PST_1962
Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: PST_1961
Name: PF01593 Funciton: Flavin containing amine oxidoreductase
Locus tag: PST_1960
Name: PF07103 Funciton: Protein of unknown function DUF1365
Locus tag: PST_1959
Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: PST_1958
Name: mcp4 Funciton: methyl-accepting chemotaxis protein |
||||
| COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-mcp4 | -217 | 5.3 | TATACATGGTTATTCGAATGTACA | PST_1966 |