Orthologous regulated operons containing mcp4 gene

Properties
Regulog:	PhrR - Pseudomonadaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Blue light; Adenosylcobalamin
Phylum:	Proteobacteria/Gamma

Built upon 43 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Pseudomonas stutzeri A1501
Position: -217 Score: 5.29583 Sequence: TATACATGGTTATTCGAATGTACA Locus tag: PST_1966 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: PST_1965 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: PST_1964 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: PST_1963 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: PST_1962 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: PST_1961 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: PST_1960 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: PST_1959 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: PST_1958 Name: mcp4 Funciton: methyl-accepting chemotaxis protein
COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-mcp4	-217	5.3	TATACATGGTTATTCGAATGTACA	PST_1966

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --