Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF00106 gene

Properties
Regulog: PhrR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Blue light; Adenosylcobalamin
Phylum: Proteobacteria/Gamma
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas entomophila L48
Position: -94
Score: 6.06155
Sequence: TGTACAAGACTATTGACCTGTACA
Position: -43
Score: 4.64607
Sequence: TGTACAAAATCACCTCGCTGTACA
Locus tag: PSEEN2706
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: PSEEN2705
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: PSEEN2704
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: PSEEN2703
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: PSEEN2702
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: PSEEN2701
Name: PF11086
Funciton: Protein of unknown function DUF2878
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 -94 6.1 TGTACAAGACTATTGACCTGTACA PSEEN2706
-43 4.6 TGTACAAAATCACCTCGCTGTACA
Pseudomonas fluorescens Pf-5
Position: -97
Score: 6.48806
Sequence: TATACAAATAATTTGACTTGTACA
Locus tag: PFL_5145
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: PFL_5146
Name: phrR
Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: PFL_5147
Name: phr
Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: PFL_5148
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: PFL_5149
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: PFL_5150
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: PFL_5151
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: PFL_5152
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: PFL_5153
Name: PF11086
Funciton: Protein of unknown function DUF2878
COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 -97 6.5 TATACAAATAATTTGACTTGTACA PFL_5145
Pseudomonas mendocina ymp
Position: -92
Score: 6.38811
Sequence: TGTACAAATCATTTGACTTGTACA
Position: -42
Score: 5.15889
Sequence: TGTACATGCACCAACATATGTACA
Locus tag: Pmen_1073
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: Pmen_1072
Name: phrR
Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: Pmen_1071
Name: phr
Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: Pmen_1070
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: Pmen_1069
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: Pmen_1068
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: Pmen_1067
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: Pmen_1066
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: Pmen_1065
Name: PF11086
Funciton: Protein of unknown function DUF2878
COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 -92 6.4 TGTACAAATCATTTGACTTGTACA Pmen_1073
-42 5.2 TGTACATGCACCAACATATGTACA
Pseudomonas putida KT2440
Position: -94
Score: 6.08141
Sequence: TATACAAGACCGTTGACTTGTATA
Position: -43
Score: 5.68758
Sequence: TGTACAACAATTCAATTTTGTACA
Locus tag: PP2738
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: PP2737
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: PP2736
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: PP2735
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: PP2734
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: PP2733
Name: PF11086
Funciton: Protein of unknown function DUF2878
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 -94 6.1 TATACAAGACCGTTGACTTGTATA PP2738
-43 5.7 TGTACAACAATTCAATTTTGTACA
Pseudomonas stutzeri A1501
Position: -217
Score: 5.29583
Sequence: TATACATGGTTATTCGAATGTACA
Locus tag: PST_1966
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: PST_1965
Name: phrR
Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: PST_1964
Name: phr
Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: PST_1963
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: PST_1962
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: PST_1961
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: PST_1960
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: PST_1959
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: PST_1958
Name: mcp4
Funciton: methyl-accepting chemotaxis protein
COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-mcp4 -217 5.3 TATACATGGTTATTCGAATGTACA PST_1966
Pseudomonas syringae pv. tomato str. DC3000
Position: -101
Score: 6.12539
Sequence: TCTACAAAGAATTTGACTTGTACA
Position: -51
Score: 4.88574
Sequence: TGTACAGCACAGTTAATCTGTACA
Locus tag: PSPTO1123
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: PSPTO1122
Name: phrR
Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: PSPTO1121
Name: phr
Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: PSPTO1120
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: PSPTO1119
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: PSPTO1118
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: PSPTO1117
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: PSPTO1116
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: PSPTO1115
Name: PF11086
Funciton: Protein of unknown function DUF2878
COG3272-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 -101 6.1 TCTACAAAGAATTTGACTTGTACA PSPTO1123
-51 4.9 TGTACAGCACAGTTAATCTGTACA