Orthologous regulated operons containing PF08888 gene

Properties
Regulog:	PhrR - Pseudomonadaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Blue light; Adenosylcobalamin
Phylum:	Proteobacteria/Gamma

Built upon 43 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Azotobacter vinelandii AvOP
Position: -78 Score: 4.40369 Sequence: TGTACAAAGCGGGACACTGCTATA Locus tag: Avin_10270 Name: folM Funciton: FolM Alternative dihydrofolate reductase 1 Locus tag: Avin_10260 Name: folB Funciton: Dihydroneopterin triphosphate epimerase Locus tag: Avin_10250 Name: PF06844 Funciton: protein of unknown function DUF1244 Locus tag: Avin_10240 Name: PF08888 Funciton: HopJ type III effector protein
folM-folB-PF06844-PF08888	-78	4.4	TGTACAAAGCGGGACACTGCTATA	Avin_10270
Pseudomonas mendocina ymp
Position: -251 Score: 5.58199 Sequence: TGTACAAAACACATGGATCGTACA Position: -118 Score: 4.56068 Sequence: TGTACAACCCGCAGCTCTGGTATA Locus tag: Pmen_3288 Name: folM Funciton: FolM Alternative dihydrofolate reductase 1 Locus tag: Pmen_3289 Name: folE Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 1 Locus tag: Pmen_3290 Name: folB Funciton: Dihydroneopterin triphosphate epimerase Locus tag: Pmen_3291 Name: PF06844 Funciton: protein of unknown function DUF1244 Locus tag: Pmen_3292 Name: PF08888 Funciton: HopJ type III effector protein
folM-folE-folB-PF06844-PF08888	-251	5.6	TGTACAAAACACATGGATCGTACA	Pmen_3288
	-118	4.6	TGTACAACCCGCAGCTCTGGTATA
Pseudomonas syringae pv. tomato str. DC3000
Position: -101 Score: 6.0939 Sequence: TGTACAAAAAAATTCTCTGGTATA Locus tag: PSPTO1183 Name: folM Funciton: FolM Alternative dihydrofolate reductase 1 Locus tag: PSPTO1182 Name: folE Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 1 Locus tag: PSPTO1181 Name: folB Funciton: Dihydroneopterin triphosphate epimerase Locus tag: PSPTO1180 Name: PF06844 Funciton: protein of unknown function DUF1244 Locus tag: PSPTO1179 Name: PF08888 Funciton: HopJ type III effector protein
folM-folE-folB-PF06844-PF08888	-101	6.1	TGTACAAAAAAATTCTCTGGTATA	PSPTO1183