Orthologous regulated operons containing sgaR gene
| Regulog: | AraQ - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium bifidum NCIMB 41171 | ||||
|
Position: -130
Score: 5.54357 Sequence: AATTGGGAGCGCTCACATAT
Locus tag: BbifN4_010100001332
Name: sgaR Funciton: Putative transcriptional regulator of L-ascorbate utilization, SorC family |
||||
| sgaR | -130 | 5.5 | AATTGGGAGCGCTCACATAT | BbifN4_010100001332 |