Orthologous regulated operons containing lyxK gene

Properties
Regulog:	AraQ - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization
Effector:
Phylum:	Actinobacteria

Built upon 83 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium bifidum NCIMB 41171
Position: -238 Score: 5.54357 Sequence: ATATGTGAGCGCTCCCAATT Locus tag: BbifN4_010100001337 Name: gatC Funciton: putative PTS system, galactitol-specific IIC component Locus tag: BbifN4_010100001342 Name: lyxK Funciton: L-xylulose kinase (EC 2.7.1.-) Locus tag: BbifN4_010100001347 Name: sgaU Funciton: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-) Locus tag: BbifN4_010100001352 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
gatC-lyxK-sgaU-araD	-238	5.5	ATATGTGAGCGCTCCCAATT	BbifN4_010100001337

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --