Orthologous regulated operons containing gatC gene
| Regulog: | AraQ - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium bifidum NCIMB 41171 | ||||
|
Position: -238
Score: 5.54357 Sequence: ATATGTGAGCGCTCCCAATT
Locus tag: BbifN4_010100001337
Name: gatC Funciton: putative PTS system, galactitol-specific IIC component
Locus tag: BbifN4_010100001342
Name: lyxK Funciton: L-xylulose kinase (EC 2.7.1.-)
Locus tag: BbifN4_010100001347
Name: sgaU Funciton: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
Locus tag: BbifN4_010100001352
Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
||||
| gatC-lyxK-sgaU-araD | -238 | 5.5 | ATATGTGAGCGCTCCCAATT | BbifN4_010100001337 |