Orthologous regulated operons containing araE gene
| Regulog: | AraQ - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium angulatum DSM 20098 | ||||
|
Position: -347
Score: 5.28202 Sequence: TTTTGAGAGCGTTCACATCA
Position: -176
Score: 5.35149 Sequence: AAATGTGAGCGATAACATTT
Locus tag: BIFANG_00188
Name: araE Funciton: L-arabinose-proton symporter
Locus tag: BIFANG_00187
Name: araB Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BIFANG_00186
Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BIFANG_00185
Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) |
||||
| araE-araB-araD-araA | -347 | 5.3 | TTTTGAGAGCGTTCACATCA | BIFANG_00188 |
| -176 | 5.4 | AAATGTGAGCGATAACATTT | ||