Orthologous regulated operons containing idnO gene
| Regulog: | GntR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -91
Score: 7.42686 Sequence: TAGGGGTATCGATACACCTA
Locus tag: BDP_1687
Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: BDP_1688
Name: gntP Funciton: Gluconate permease |
||||
| idnO-gntP | -91 | 7.4 | TAGGGGTATCGATACACCTA | BDP_1687 |