Orthologous regulated operons containing BDP_1268 gene
| Regulog: | BDP_1267 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | ||||
|
Position: -86
Score: 5.95205 Sequence: TTATTTGAACGTTCTAATGA
Locus tag: BIFBRE_00099
Name: BDP_1268 Funciton: Putative carbohydrate ABC transporter, solute-binding protein
Locus tag: BIFBRE_00100
Name: BDP_1269 Funciton: Putative carbohydrate ABC transporter, permease protein 2
Locus tag: BIFBRE_00101
Name: BDP_1270 Funciton: Putative carbohydrate ABC transporter, permease protein
Locus tag: BIFBRE_00102
Name: BDP_1271 Funciton: Putative amylo-alpha-1,6-glucosidase |
||||
| BDP_1268-BDP_1269-BDP_1270-BDP_1271 | -86 | 6 | TTATTTGAACGTTCTAATGA | BIFBRE_00099 |
| Bifidobacterium dentium Bd1 | ||||
|
Position: -50
Score: 5.83497 Sequence: AAATTAGAACGTTCTAATTA
Locus tag: BDP_1268
Name: BDP_1268 Funciton: Putative carbohydrate ABC transporter, solute-binding protein
Locus tag: BDP_1269
Name: BDP_1269 Funciton: Putative carbohydrate ABC transporter, permease protein 2
Locus tag: BDP_1270
Name: BDP_1270 Funciton: Putative carbohydrate ABC transporter, permease protein
Locus tag: BDP_1271
Name: BDP_1271 Funciton: Putative amylo-alpha-1,6-glucosidase |
||||
| BDP_1268-BDP_1269-BDP_1270-BDP_1271 | -50 | 5.8 | AAATTAGAACGTTCTAATTA | BDP_1268 |