Orthologous regulated operons containing sgaT2 gene
| Regulog: | SgaR2 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium bifidum NCIMB 41171 | ||||
|
Position: -137
Score: 5.57763 Sequence: TTGAGAAATCGGTTTCCGGG
Locus tag: BbifN4_010100009110
Name: sgaA2 Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69)
Locus tag: BbifN4_010100009115
Name: sgaB2 Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: BbifN4_010100009120
Name: sgaT2 Funciton: Ascorbate-specific PTS, EIIC component |
||||
| sgaA2-sgaB2-sgaT2 | -137 | 5.6 | TTGAGAAATCGGTTTCCGGG | BbifN4_010100009110 |
| Gardnerella vaginalis 409-05 | ||||
|
Position: -140
Score: 6.05283 Sequence: TACAGAAAACGTTTTCACTT
Locus tag: HMPREF0424_1268
Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Locus tag: HMPREF0424_1267
Name: sgaA2 Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69)
Locus tag: HMPREF0424_1266
Name: sgaB2 Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: HMPREF0424_1265
Name: null Funciton: putative lipoprotein
Locus tag: HMPREF0424_1264
Name: sgaT2 Funciton: Ascorbate-specific PTS, EIIC component |
||||
| ptsI-sgaA2-sgaB2-HMPREF0424_1265-sgaT2 | -140 | 6.1 | TACAGAAAACGTTTTCACTT | HMPREF0424_1268 |