Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing HMPREF0424_1265 gene

Properties
Regulog: SgaR2 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Actinobacteria
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Gardnerella vaginalis 409-05
Position: -140
Score: 6.05283
Sequence: TACAGAAAACGTTTTCACTT
Locus tag: HMPREF0424_1268
Name: ptsI
Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Locus tag: HMPREF0424_1267
Name: sgaA2
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69)
Locus tag: HMPREF0424_1266
Name: sgaB2
Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: HMPREF0424_1265
Name: null
Funciton: putative lipoprotein
Locus tag: HMPREF0424_1264
Name: sgaT2
Funciton: Ascorbate-specific PTS, EIIC component
ptsI-sgaA2-sgaB2-HMPREF0424_1265-sgaT2 -140 6.1 TACAGAAAACGTTTTCACTT HMPREF0424_1268