Orthologous regulated operons containing susC_Rgu-4 gene
| Regulog: | AraR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -329
Score: 5.07565 Sequence: AAATTGTATTATCTACACTCT
Locus tag: BT4163
Name: BT4163 Funciton: Fasciclin, PF02469 family
Locus tag: BT4164
Name: susC_Rgu-3 Funciton: TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides
Locus tag: BT4165
Name: susD_Rgu-3 Funciton: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides
Locus tag: BT4166
Name: BT4166 Funciton: hypothetical protein, DUF5075, DUF5076
Locus tag: BT4167
Name: BT4167 Funciton: Fasciclin domain, PF02469 family
Locus tag: BT4168
Name: susC_Rgu-4 Funciton: TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides
Locus tag: BT4169
Name: susD_Rgu-4 Funciton: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides
Locus tag: BT4170
Name: pelL Funciton: Pectate lyase L (EC 4.2.2.2)
Locus tag: BT4171
Name: BT4171 Funciton: hypothetical protein, PF16408 family |
||||
| BT4163-susC_Rgu-3-susD_Rgu-3-BT4166-BT4167-susC_Rgu-4-susD_Rgu-4-pelL-BT4171 | -329 | 5.1 | AAATTGTATTATCTACACTCT | BT4163 |