Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing abn4 gene

Properties
Regulog: AraR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Bacteroidetes
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides cellulosilyticus DSM 14838
Position: -39
Score: 5.35733
Sequence: TATGTGTATTTTTGACACCCA
Locus tag: BACCELL_00858
Name: abn3
Funciton: Arabinoxylan arabinofuranohydrolase, GH43 family
Locus tag: BACCELL_00859
Name: agaL
Funciton: alpha-glucosidase, GH97 family
Locus tag: BACCELL_00860
Name: abf3
Funciton: alpha-N-arabinofuranosidase, GH51 family
Locus tag: BACCELL_00861
Name: abf4
Funciton: alpha-N-arabinofuranosidase, GH51 family
Locus tag: BACCELL_00862
Name: bgaL
Funciton: beta-galactosidase, GH2 family
Locus tag: BACCELL_00863
Name: abn4
Funciton: arabinan endo-1,5-alpha-L-arabinosidase, GH43 family
abn3-agaL-abf3-abf4-bgaL-abn4 -39 5.4 TATGTGTATTTTTGACACCCA BACCELL_00858
© 2009-2020 RegPrecise