Orthologous regulated operons containing BT0352 gene
| Regulog: | AraR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -84
Score: 5.59526 Sequence: AGAGTGTATTTGATACACCAA
Position: -60
Score: 5.75141 Sequence: AAAGTGTTACTTTTACACCCA
Locus tag: BT0356
Name: araM Funciton: L-arabinose mutarotase
Locus tag: BT0355
Name: araP Funciton: Predicted sodium-dependent arabinose transporter, MFS family
Locus tag: BT0354
Name: araR Funciton: Transcriptional regulator for arabinose utilization, NrtR family
Locus tag: BT0353
Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BT0352
Name: BT0352 Funciton: hypothetical protein
Locus tag: BT0351
Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BT0350
Name: araB Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BT0349
Name: COG3533 Funciton: COG3533 secreted protein
Locus tag: BT0348
Name: abf1 Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
||||
| araM-araP-araR-araD-BT0352-araA-araB-COG3533-abf1 | -84 | 5.6 | AGAGTGTATTTGATACACCAA | BT0356 |
| -60 | 5.8 | AAAGTGTTACTTTTACACCCA | ||