Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing susC_Ara-1 gene

Properties
Regulog: AraR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Bacteroidetes
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides thetaiotaomicron VPI-5482
Position: -167
Score: 5.71599
Sequence: AAAGTGTAAAAAAGACACTTA
Locus tag: BT0365
Name: PF13385
Funciton: Concanavalin A-like lectin/glucanases superfamily
Locus tag: BT0364
Name: susC_Ara-1
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BT0363
Name: susD_Ara-1
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BT0362
Name: susC_Ara-2
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BT0361
Name: susD_Ara-2
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BT0360
Name: abn1
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
PF13385-susC_Ara-1-susD_Ara-1-susC_Ara-2-susD_Ara-2-abn1 -167 5.7 AAAGTGTAAAAAAGACACTTA BT0365